Cycle Sequence Reactions For Large Insert Plasmid Templates

The following dye-labeled terminator reaction chemistries have been designed to balance conservation of reagents with the resulting sequence product signal strength.  When coupled with BACPAC Resource template preparation, N-free read lengths of >400nts can be expected.  More emphasis can be placed on reagent conservation by further volume reduction or dilution; or on sequence product signal strength by increasing the reaction size.

CycleSequenceConditions:

(1) Initial denaturation step:  96^oC 4min.

(2) denaturation:  96^oC 10sec.

(3) annealing:  50^oC 10sec.

(4) extension:  60^oC 4min. run steps 2-4 for 100 cycles.

(5) hold:  4-10^oC.

Primers Useful For BAC and PAC Vectors:

T7.29:  5’ gccgctaatacgactcactatagggagag    29mer

T7:   5’ taatacgactcactataggg     20mer

gSP6:  5’gttttttgcgatctgccgtttc     22mer

³Stock ABI Ready Reaction mixes are supplemented with 4mM MgCl2

⁴ Refers to ABI 1x (20ul) reaction

⁵ Annealing temp can be adjusted, based on Tm of primers used